The International Journal of Applied Research
in Veterinary Medicine

Current Issue

Previous Issues

Reprint Information

Back to The International Journal of Applied Research in Veterinary Medicine

Published papers are provided for individual personal use only, if you would like to use any of these papers for any other purpose please contact James Morrice at jmorrice@jarvm.com.

©2000-2003. All Rights Reserved. Veterinary Solutions LLC

Click here for information on how to order reprints of this article.

Immunization Against Anaplasma marginale Major Surface Protein 1a Reduces Infectivity for Ticks

 

José de la Fuente*

Katherine M. Kocan*

Jose C. Garcia-Garcia*

Edmour F. Blouin*

Thomas Halbur

Virginia Onet

 

*Department of Veterinary Pathobiology, College of Veterinary Medicine, Oklahoma State University, Stillwater, Oklahoma, USA

Norvartis Animal Vaccines, Inc., Larchwood, Iowa, USA

 

KEY WORDS: rickettsia, tick cell culture, major surface protein, immunization, vaccine

ABSTRACT

Anaplasma marginale, a tick-borne pathogen of cattle, establishes persistent infections in cattle and ticks, and both hosts serve as reservoirs of infection for mechanical and biological transmission. Tick gut cells become infected when ticks feed on infected cattle and, after a second tick feeding, salivary glands become infected from where the pathogen is transmitted to cattle. In this study, we conducted a preliminary trial to test whether immunization of cattle against major surface protein (MSP) 1a would reduce A. marginale infections in male Dermacentor variabilis that acquired infection by feeding on these cattle. Cattle were immunized with either recombinant MSP1a or with a combination of recombinant MSP1a and A. marginale derived from tick cell culture, whereas nonimmunized cattle served as control hosts. Cattle with antibody titers to MSP1a were identified by Western blot. Two weeks after immunization, all cattle were challenge-exposed with 109 A. marginale-infected erythrocytes. When cattle became rickettsemic, ticks were allowed to feed on them for 7 days. Salivary glands were dissected after a second tick feeding on sheep, and A. marginale infection levels were determined by quantitative polymerase chain reaction. Although peak rickettsemias of cattle during tick feeding were not different among immunized and control cattle, tick salivary gland infections were significantly lower in ticks that fed on the MSP1a-immunized cattle. These results provide further evidence that infection of ticks with A. marginale involves MSP1a and that MSP1a could be useful to incorporate in development of improved vaccines for anaplasmosis that reduce both clinical disease and tick transmission.

Introduction

Anaplasmosis is a tick-borne disease of cattle caused by Anaplasma marginale (Rickettsiales: Anaplasmataceae). The only known site of development of A. marginale in cattle is within erythrocytes.1 The number of infected erythrocytes increases logarithmically during infection, and removal of infected erythrocytes by phagocytic cells of the reticuloendothelial system often results in development of anemia and icterus without hemoglobinemia and hemoglobinuria.2 Although mechanical transmission of A. marginale occurs when infected blood is transferred from infected to susceptible animals by biting flies or blood-contaminated fomites, biological transmission is effected by feeding ticks. Approximately 20 species of ticks have been incriminated as vectors worldwide but Dermacentor variabilis and D. andersoni (Acari: Ixodidae) constitute the main vectors in the United States.1 Cattle that recover from acute infection remain persistently infected and serve as reservoirs of infection for mechanical and/or biological transmission by ticks.

The developmental cycle of A. marginale in ticks is complex and coordinated with the tick feeding.1 In the life cycle of A. marginale that was described in male ticks transferred from infected to susceptible hosts, the first site of infection occurs in tick gut cells. After the ticks feed a second time, many other tissues become infected, including the salivary glands from where the rickettsiae are transmitted to cattle during feeding. Male ticks become persistently infected with A. marginale and are able to transmit the pathogen to multiple hosts.1

The major surface protein (MSP) 1a is 1 of 6 MSPs that have been described on A. marginale derived from bovine erythrocytes.1 MSP1a forms the MSP1 complex with MSP1b. MSP1a is encoded by a single gene, msp1a, which is conserved during the multiplication of the rickettsia in cattle and ticks.3–5 This protein is variable in molecular weight among geographic isolates because of varying numbers of tandem 28 or 29 amino acid repeats located in the amino terminal portion of the protein.6–11 MSP1a was shown to be an adhesin for bovine erythrocytes and for both native and cultured tick cells using recombinant Escherichia coli expressing MSP1a in microtiter hemagglutination and adhesion recovery assays and by microscopy.12–14 Furthermore, MSP1a was shown to be involved in infection and transmission of A. marginale by Dermacentor spp.15 and was also shown to be involved in bovine immunity to A. marginale infection.16–20

Recently, we demonstrated that infection of A. marginale for cultured tick cells was inhibited by antibodies against recombinant MSP1a.21,22 Although antisera from cattle naturally infected with A. marginale did not inhibit A. marginale infection, antibodies produced in rabbits and cattle immunized with the recombinant MSP1a inhibited A. marginale infection of the cultured tick cells.22 This inhibitory effect was also demonstrated using antibodies against a synthetic MSP1a repeated peptide, and this data provided additional evidence that MSP1a plays a role in adhesion of A. marginale to tick cells.9

The present study was undertaken to determine whether immunization of cattle with MSP1a would reduce infection levels in male D. variabilis feeding on A. marginale-infected cattle.

Materials and Methods

Cattle Vaccination and Challenge

Twenty Holstein cattle, 12 to 24 months old, were used for this study. These cattle were selected from 55 cattle used for a larger vaccine trial that were randomly assigned to 2 experimental groups of 20 cattle each and one group of 15 control cattle in which group 1 cattle were immunized with 3 isolates of A. marginale derived from tick cell culture (Virginia, Oklahoma, and Oregon isolates) and 100 µg recombinant MSP1a, group 2 cattle were immunized with 100 µg recombinant MSP1a, and cattle in group 3 were left unvaccinated to serve as controls for natural infection conditions. Ten immunized cattle were selected for this study based on detection of antibody titers against recombinant MSP1a by Western blot. Of these 10 cattle, 5 were chosen from group 1 (cattle 226, GT168, 242, 294, 141) and 5 were chosen from group 2 (cattle GT165, GT155, 219, 248, GT152). For the nonimmunized controls, 10 cattle (214, 210, 245, 251, 143, 157, 247, 217, 166, 162) were randomly chosen out of the 15 control cattle from the larger study and were demonstrated to be free of anti-MSP1a antibodies by Western blot.

A. marginale antigens from infected IDE8 cells were prepared as described previously.19,20 Recombinant MSP1a was prepared by inducing the expression of the protein in E. coli.14 The E. coli cells were then disrupted by sonication followed by centrifugation for the separation of soluble from membrane-bound antigens. The resulting pellet that contained the MSP1a in E. coli membranes was used for immunization. The total protein concentration was determined and the amount of recombinant MSP1a was estimated from Western blots using affinity purified recombinant MSP1a as a standard.20

Cattle were immunized at weeks 0 and 4 with a 5-mL dose containing the antigen in an oil-based adjuvant (Adjuvant XtendIII®; Grand Laboratories, Larchwood, IA).19 Cattle were challenged 2 weeks after the last immunization (week 6) by intravenous administration of 1.7 mL infected blood containing 109 A. marginale. The challenge blood was obtained from a splenectomized calf that was experimentally infected with the Virginia isolate of A. marginale (calf PA481, percent infected erythrocytes [PPE] of 10.4%, packed cell volume [PCV] of 31.5%). Parameters used for evaluation of cattle included determination of the PPE and PCV. Whole blood was collected in Vacutainer tubes containing etuylenediamine tetra-acetic acid (EDTA) and used for preparation of stained blood smears for light microscopy and for determination of the PCV. Serum samples were collected from each animal on purchase, at weeks 0 and 4 before each immunization, at week 6 before challenge, and during tick feeding. Serum samples were stored at –70oC until tested by enzyme-linked immunosorbent assay and Western blots for determination of anti-MSP1a antibody titers.

Identification of Cattle With Antibody Titers to MSP1a, Tick Feeding Studies, and Determination of A. marginale Infection Levels in Tick Salivary Glands

Serum samples collected from cattle 2 weeks after the last immunization (week 6) were analyzed as described previously by Western blot for recognition of recombinant MSP1a.20 The antibody response to MSP1a was estimated from Western blots, including affinity purified recombinant MSP1a as a standard.20 Ten immunized animals with good recognition of MSP1a by Western blot were selected from groups 1 and 2 (5 animals from each). Ten control animals from group 3 were randomly selected and sera from these cattle were proven to be negative for MSP1a antibodies by Western blot. Sera from the cattle collected 5 to 10 days after tick infestation were analyzed by enzyme-linked immunosorbent assay for antibody titers against recombinant MSP1a as described by de la Fuente et al.20 together with the same sera used in Western blot analysis.

 Each of the 20 cattle were infested with 60 male D. variabilis that were reared at the Oklahoma State University, Centralized Tick Rearing Facility. The ticks were placed in an orthopedic stockinette glued to the cow’s side when A. marginale infection was observed in stained blood smears. The ticks were allowed to feed on cattle for 7 days, after which they were removed and held in a humidity chamber for 5 days. The ticks were then allowed to feed for 7 days on a sheep to stimulate the development of A. marginale into tick salivary glands. The ticks were then removed from the sheep, and the salivary glands from 20 ticks per cow (40 salivary glands) were dissected and pooled in 500 µL RNALater (Ambion, Austin, TX). DNA was extracted from groups of 40 salivary glands using 500 µL Tri Reagent (Sigma) and homogenized with a 1-mL tuberculin syringe with a 25-g needle. DNA was then used in a quantitative polymerase chain reaction20 to quantitate A. marginale infection levels. Primers used for identification of A. marginale were based on msp4, a highly conserved single-copy gene (primers MSP45: 5’GGGAGCTCCTATGAATTACAGAGAATTGTTTAC3’ and MSP43: 5’CCGGATCCTTAGCTGAACAGGAATCTTGC3’.14 The tick 16S mitochondrial rDNA was used as an unrelated standard using primers designed for Dermacentor spp. (primers D16S5: 5’GAATGCTAAGAGAATGGAAT3’ and D16S3: 5’GTCTGAACTCAGATCAAGT3’.14 Polymerase chain reaction was performed using the Access RT-PCR system (Promega, Madison, WI). To a constant amount (100 ng) of target DNA, 10 pmol of each primer were added in a reaction volume of 50 µL (1.5 mM MgSO4, 0.2 mM dNTP, 1X AMV/Tfl reaction buffer, 5u Tfl DNA polymerase). Reactions were performed in an automated DNA thermal cycler (Mastercycler; Eppendorf, Westbury, NY) for 35 cycles. After an initial denaturation step of 30 seconds at 94˚C, each cycle consisted of a denaturing step of 30 seconds at 94˚C, annealing for 30 seconds at 52˚C, and an extension step of 1 minute at 68˚C. The program ended by storing the reactions at 4˚C. Polymerase chain reaction products were then electrophoresed on 1% agarose gels, and the amount of amplified products determined in nanograms against a DNA standard. Under these conditions, the amount of amplified 16S rDNA standard was constant (70 ± 7 ng) and the amount of amplified msp4 (Tn) was proportional to the number of A. marginale (S0) in a linear range between 2 and 107 parasites (log Tn = 0.4 logS0 + 0.5). The number of msp4 copies was then calculated as 10 [(l˚g Tn – 0.5)/0.4].

Statistical Analysis

For the analysis of the PPE and percent reduction PCV after tick infestation between immunized and control cattle, pairwise comparisons (Student’s t test) were conducted. Anti-MSP1a antibody titers between immunized and control cattle were compared by analysis of variance. Salivary gland infection levels between ticks fed on vaccinated and control cattle were compared by Student’s t test. Correlation analysis was done using Microsoft Excel 2000.

Results and Discussion

Vaccination is the most efficient and economical method for control of anaplasmosis, and development of effective vaccines has been a priority of the cattle industry worldwide.1 Infected bovine erythrocytes have been the only source of vaccine antigen until recently when a tick cell culture system was developed for propagation of A. marginale and provides an alternative antigen source. The cell culture-derived A. marginale is currently being tested as an antigen for use in vaccine development.19,20

Thus far, vaccines using erythrocyte or cell culture-derived antigens have effected reduction of clinical disease but have not prevented infection of cattle.1 Also, cattle immunized with erythrocyte-derived A. marginale have not caused reduction of A. marginale infections in ticks.23 Development of an anaplasmosis vaccine that would reduce tick infections and biologic transmission of A. marginale would be an improvement over previous vaccines. The first step toward this objective, as demonstrated by these data on MSP1a, is to identify A. marginale antigens, which after vaccination, result in the reduction of A. marginale infection levels in ticks.

Cattle chosen for these studies after vaccination and before challenge and tick feeding were based on the detection of an antibody response against MSP1a by Western blot. After vaccination, cattle were challenged with A. marginale-infected blood and then infested with D. variabilis. Mean peak PPE (± standard deviation [SD]) (3.6 ± 2.6 and 3.2 ± 1.7 for control and immunized cattle, respectively) and mean percent reduction of PCV (± SD) (29.3 ± 7.0 and 26.8 ± 12.2 for control and immunized cattle, respectively) of immunized and control cattle during tick feeding were not significantly different (P >0.05) (Table 1). No correlation (P = 0.4) was observed between the level of rickettsemia (peak PPE) during tick acquisition-feeding and the A. marginale-infection levels in tick salivary glands.

In a previous experiment, we demonstrated that A. marginale infection levels in ticks fed on cattle immunized with E. coli membranes, and uninfected cultured IDE8 tick cell-derived antigens were similar to the infection levels in ticks fed on nonimmunized cattle (unpublished results). Therefore, cattle in the control group were left unvaccinated to reproduce natural infection conditions after administration of A. marginale-infected blood. The infection rates between ticks that fed on immunized and control cattle were not affected by the A. marginale infections in cattle or the percent reduction PCVs during tick feeding. The PPEs in the cattle during tick feeding were not statistically different among groups and the percent reduction PCVs was not low enough to affect tick feeding.

Antibody titers against MSP1a were determined by enzyme-linked immunosorbent assay in sera obtained 2 weeks after vaccination (peak antibody titer) and after challenge and tick infestation and compared between immunized and control cattle (Table 1). Mean anti-MSP1a antibody titers in cattle immunized with recombinant MSP1a (± standard error [SE]) (440 ± 157 and 840 ± 337), recombinant MSP1a plus IDE8-derived A. marginale (160 ± 68 and 200 ± 89), and controls (20 ± 19 and 110 ± 49) were different (F = 8.3; P = 0.003 and F = 6.24; P = 0.009) after vaccination and after challenge and tick infestation, respectively. Mean antibody titers increased after challenge, although in some animals, the antibody response to MSP1a determined by enzyme-linked immunosorbent assay was weak or null (Table 1). Differences in the results obtained by Western blot and enzyme-linked immunosorbent assay in sera collected before challenge could be the result of the qualitative nature of the Western blot compared with the enzyme-linked immunosorbent assay. Nevertheless, all vaccinated animals except one had detectable anti-MSP1a antibody levels by ELISA (Table 1).

Average A. marginale infection levels in salivary glands from ticks that fed on rickettsemic immunized and control cattle are listed in Table 1. As was reported in previous studies,14,24 salivary gland infection levels were probably variable and reflected variation among individual ticks. Nevertheless, the mean number of msp4 copies per salivary gland was higher (P = 0.04) in ticks that fed on control cattle (214 ± 98; mean ± SE) when compared with ticks that fed on immunized cattle (18 ± 8), suggesting that although the analysis was done on pooled tick salivary glands, ticks with high A. marginale infection levels were less represented in vaccinated than in control cattle. Differences were not observed between ticks that fed on cattle immunized with recombinant MSP1a or with IDE8-derived A. marginale together with recombinant MSP1a.

The results reported here suggest that immunization of cattle with MSP1a reduced infection of A. marginale for D. variabilis. Differences in salivary gland infection levels between ticks fed on immunized and control cattle agreed with statistically significant differences in the anti-MSP1a antibody titers between immunized and control cattle before and after challenge and tick infestation, suggesting a role for anti-MSP1a antibodies in the reduction of tick infection levels. Differences in the results obtained after vaccination with recombinant MSP1a (immunized group) compared with the immune response generated after infection of cattle with A. marginale (control group) could be explained by differences in the anti-MSP1a antibody levels and/or by differences in the MSP1a epitopes recognized by the antibodies. The recombinant MSP1a protein is presented separately to the bovine immune system rather than as a complex with MSP1b, which appears to allow for recognition of all the epitopes in the region containing the tandem repeats involved in adhesion of MSP1a to tick cells.9 The antibodies against the native MSP1a might not be directed against the neutralizing domain masked by the structure of the MSP1 complex.

Comparison of the data obtained from cattle vaccinated with recombinant MSP1a or with IDE8-derived A. marginale together with recombinant MSP1a suggested that the antibody response against IDE8 and IDE8-derived A. marginale antigens, other than MSP1a, had little or no inhibitory effect on tick infection. However, an independent and/or synergistic effect of tick antigens could not be precluded.

The antibody response against MSP1a inhibited but did not prevent infection of ticks by A. marginale. Although the effect on the transmission of A. marginale by ticks fed on vaccinated cattle is unknown, these ticks are likely to transmit the pathogen. Therefore, this study suggests that MSP1a could be necessary but not sufficient for infection of ticks by A. marginale. Alternatively, overexpression of MSP1a in erythrocytic stages of A. marginale and/or the native structure of MSP1a could prevent the complete neutralization of the ligand.25

The ultimate goal for a vaccine for the control of anaplasmosis would be to have a protection effect on the multiplication of A. marginale in the bovine host and a blocking effect on the transmission of the pathogen by the tick vector. The results reported here, although preliminary, support the role of MSP1a in the transmission of A. marginale by ticks and suggest the incorporation of recombinant MSP1a in vaccine formulations against A. marginale in combination with infected IDE8 cells-derived antigens and/or as-yet unidentified pathogen and tick-derived antigens.

Acknowledgments

The authors thank Dollie Clawson, Joy Yoshioka, and Robert Rickords (Department of Veterinary Pathobiology, Oklahoma State University) for technical assistance. This research was supported by project No. 1669 of the Oklahoma Agricultural Experiment Station, the Endowed Chair in Food Animal Research (K.M. Kocan, College of Veterinary Medicine, Oklahoma State University), NIH Centers for Biomedical Research Excellence through a subcontract to J. de la Fuente from the Oklahoma Medical Research Foundation, the Oklahoma Center for the Advancement of Science and Technology, Applied Research Grants, AR00(1)-001 and ARO21-0037, and a grant from Novartis Animal Vaccines, Inc., Larchwood, IA. J. C. Garcia-Garcia is supported by a Howard Hughes Medical Institute Predoctoral Fellowship in Biological Sciences.

References

1. Kocan KM, de la Fuente J, Meléndez RD, Guglielmone AA: Anaplasma marginale: antigens and control alternatives for a rickettsial hemoparasite of cattle. Clin Micro Rev 16:698–712, 2003.

2. Kuttler KL: Anaplasma infections in wild and domestic ruminants: a review. J Wild Dis 20:12–20, 1984.

3. Barbet AF, Blentlinger R, Yi J, et al: Comparison of surface proteins of Anaplasma marginale grown in tick cell culture, tick salivary glands, and cattle. Infect Immun 67:102–107, 1999.

4. Palmer GH, Rurangirwa FR, McElwain TF: Strain composition of the ehrlichia Anaplasma marginale within persistently infected cattle, a mammalian reservoir for tick transmission. J Clin Microbiol 39:631–635, 2001.

5. Bowie MV, de la Fuente J, Kocan KM, et al: Conservation of major surface protein 1 genes of the ehrlichial pathogen Anaplasma marginale during cyclic transmission between ticks and cattle. Gene 282:95–102, 2002.

6. Allred DR, McGuire TC, Palmer GH, et al: Molecular basis for surface antigen size polymorphisms and conservation of a neutralization-sensitive epitope in Anaplasma marginale. Proc Natl Acad Sci U S A 87:3220–3224, 1990.

7. de la Fuente J, Garcia-Garcia JC, Blouin EF, et al: Evolution and function of tandem repeats in the major surface protein 1a of the ehrlichial pathogen Anaplasma marginale. Animal Health Res Rev 2:163–173, 2001a.

8. de la Fuente J, Van Den Bussche RA, Garcia-Garcia JC, et al: Phylogeography of New World isolates of Anaplasma marginale (Rickettsiaceae: Anaplasmataceae) based on major surface protein sequences. Vet Microbiol 88:275–285, 2002a.

9. de la Fuente J, Garcia-Garcia JC, Blouin EF, Kocan KM: Characterization of the functional domain of major surface protein 1a involved in adhesion of the rickettsia Anaplasma marginale to host cells. Vet Microbiol 91:265–283, 2003a.

10. de la Fuente J, Van Den Bussche RA, Prado T, Kocan KM: Anaplasma marginale major surface protein 1a genotypes evolved under positive selection pressure but are not markers for geographic isolates. J Clin Microbiol 41:1609–1616, 2003b.

11. de la Fuente J, Golsteyn Thomas EJ, Van Den Bussche RA, et al: Characterization of Anaplasma marginale isolated from North American bison. Appl Environ Microbiol 69:5001–5005, 2003c.

12. McGarey DJ, Allred DR: Characterization of hemagglutinating components on the Anaplasma marginale initial body surface and identification of possible adhesins. Infect Immun 62:4587–4593, 1994.

13. McGarey DJ, Barbet AF, Palmer GH, et al: Putative adhesins of Anaplasma marginale: major surface polypeptides 1a and 1b. Infect Immun 62:4594–4601, 1994.

14. de la Fuente J, Garcia-Garcia JC, Blouin EF, Kocan KM: Differential adhesion of major surface proteins 1a and 1b of the ehrlichial cattle pathogen Anaplasma marginale to bovine erythrocytes and tick cells. Int J Parasitol 31:145–153, 2001b.

15. de la Fuente J, Garcia-Garcia JC, Blouin EF, Kocan KM: Major surface protein 1a effects tick infection and transmission of the ehrlichial pathogen Anaplasma marginale. Int J Parasitol 31:1705–1714, 2001c.

16. Palmer GH, Waghela SD, Barbet AF, et al: Characterization of a neutralization sensitive epitope on the AM 105 surface protein of Anaplasma marginale. Int J Parasitol 17:1279–1285, 1987.

17. Brown WC, McGuire TC, Zhu D, et al: Highly conserved regions of the immunodominant major surface protein 2 of the genogroup II ehrlichial pathogen Anaplasma marginale are rich in naturally derived CD4(+) T lymphocyte epitopes that elicit strong recall responses. J Immunol 166:1114–1124, 2001.

18. Brown WC, McGuire TC, Mwangi W, et al: Major histocompatibility complex class II DR-restricted memory CD4(+) T lymphocytes recognize conserved immunodominant epitopes of Anaplasma marginale major surface protein 1a. Infect Immun 70:5521–5532, 2002.

19. Kocan KM, Halbur T, Blouin EF, et al: Immunization of cattle with Anaplasma marginale derived from tick cell culture. Vet Parasitol 102:151–161, 2001.

20. de la Fuente J, Kocan KM, Garcia-Garcia JC, et al: Vaccination of cattle with Anaplasma marginale derived from tick cell culture and bovine erythrocytes followed by challenge-exposure with infected ticks. Vet Microbiol 89:239–251, 2002b.

21. Blouin E F, de la Fuente J, Garcia-Garcia JC, et al: Use of a cell culture system for studying the interaction of Anaplasma marginale with tick cells. Animal Health Res Rev 3:57–68, 2002.

22. Blouin EF, Saliki JT, de la Fuente J, et al: Antibodies to Anaplasma marginale major surface protein 1a and 1b inhibit infectivity for cultured tick cells. Vet Parasitol 111:247–260, 2003.

23. Kocan KM, Blouin EF, Palmer GH, et al: Preliminary studies on the effect of Anaplasma marginale antibodies ingested by Dermacentor andersoni ticks (Acari: Ixodidae) with their bloodmeal on infections in salivary glands. Exp Appl Acarol 20:297–311, 1996.

24. Kocan KM, de la Fuente J: Co-feeding studies of ticks infected with Anaplasma marginale. Vet Parasitol 112:295–305, 2003.

25. Garcia-Garcia JC, de la Fuente J, Blouin EF, et al: Differential expression of the msp1a gene of Anaplasma marginale occurs in bovine erythrocytes and tick cells. Vet Microbiol. In press.

 

Table 1. Peak Percent Infected Erythrocytes During Tick Feeding on Cattle, Anti-MSP1a Antibody Titers and Infection Levels in Salivary Glands of Ticks That Acquired Infection on Immunized and Control Cattle

 

Experimental Groups Cattle No.* Immunogen Peak PPE During Tick Feeding†     Anti-MSP1a Tick Infection Levels (copies msp4/salivary gland)§
Antibody Titers‡
Vaccinated 141 IDE8-derived 4.1 <100 <100 25
  GT 168 A. marginale 1.6 100 <100 2
  226 plus 5.0 200 400 2
  242 recombinant 3.0 400 400 14
  294 MSP1a 2.8 100 200 25
  GT 152 Recombinant 0.3 800 1600 0.1
  GT 155 MSP1a 1.6 100 <100 14
  GT 165   5.8 400 1600 80
  219   4.5 100 200 2
  248   3.2 800 800 14
Control 143 None 4.3 <100 <100 140
  157   .05 <100 100 0.4
  162   3.5 <100 100 25
  166   2.5 <100 <100 795
  210   3.2 100 100 2
  214   1.9 <100 100 80
  217   1.6 <100 100 140
  245   2.4 <100 100 25
  247   6.9 100 400 140
  251   9.2 <100 100 795

*Cattle were analyzed for antibody response against recombinant MSP1a before challenge exposure. Ten immunized animals showing the highest titers against MSP1a and 10 controls with sera negative for MSP1a in the Western blot were selected.

†The percent infected erythrocytes (PPE) was determined in blood smears of samples collected daily during the 7 days of tick acquisition feeding.

‡Antibody titers were determined by enzyme-linked immunosorbent assay 2 weeks after vaccination (left column) and after challenge with A. marginale and tick infestation (right column). Values correspond to the maximum dilution that gave an OD450 nm equal or higher than mean background + 2 standard deviations.

§DNA was extracted from 40 salivary glands and used in a msp4 quantitative polymerase chain reaction to determine A. marginale infection levels.